Monsanto v. Mycogen Plant Science

CourtU.S. Court of Appeals — Federal Circuit
Writing for the CourtBefore CLEVENGER, BRYSON, and LINN; LINN
CitationMonsanto v. Mycogen Plant Science, 261 F.3d 1356 (Fed. Cir. 2001)
Decision Date16 August 2001
Parties(Fed. Cir. 2001) MONSANTO COMPANY, Plaintiff-Appellant, v. MYCOGEN PLANT SCIENCE, INC. and AGRIGENETICS, INC., Defendants-Cross Appellants, and SYNGENTA SEEDS, INC., Defendant-Cross Appellant. 00-1002, -1003, -1050 DECIDED:

Richard L. Stanley, Howrey Simon Arnold & White, of Houston, Texas, argued for plaintiff-appellant. With him on the brief were John F. Lynch, Susan K. Knoll, Michael E. Lee, and Steven G. Spears.

Daniel J. Thomasch, Orrick, Herrington & Sutcliffe LLP, of New York, New York, argued for defendants-cross appellants Mycogen Plant Science, Inc. and Agrigenetics, Inc. With him on the brief were Richard W. Mark, Lauren J. Elliot, and Marc P. Berger, of New York, New York, and Craig R. Kaufman, of Menlo Park, California. Of counsel was Geoffrey W. Millsom, of New York, New York.

Dimitrios T. Drivas, White & Case LLP, of New York, New York, argued for defendant-cross appellant SYNGENTA SEEDS, INC.. With him on the brief were John S. Willems, Leslie Morioka, and Jeffrey J. Oelke. Of counsel was Lori R. Begleiter.

Before CLEVENGER, BRYSON, and LINN, Circuit Judges.

LINN, Circuit Judge.

Monsanto Company ("Monsanto") appeals from a final judgment of invalidity and noninfringement of its U.S. Patent No. 5,500,365 (the "'365 patent"), entered by the United States District Court for Delaware on March 12, 1999. Monsanto Co. v. Mycogen Plant Science, Inc., No. 96-133-RRM (D. Del. Sep. 8, 1999) ("Opinion"). A jury returned a verdict of invalidity under 35 U.S.C. § 102(g) based on prior inventorship. In response to motions for judgment as a matter of law ("JMOL") under Rule 50(a) of the Federal Rules of Civil Procedure, the district court upheld the jury's verdict of invalidity. We affirm1.

BACKGROUND
A. Technology and '365 Patent

This court heard oral argument in this case along with two companion cases dealing with the same technology. Mycogen Plant Science, Inc. v. Monsanto Co., 234 F.3d 1316, 58 USPQ2d 1030 (Fed. Cir. 2001) ("Delaware I"); Mycogen Plant Science, Inc. v. Monsanto Co., --- F.3d ---, --- USPQ2d ---. The facts central to this appeal are discussed below. For additional background, the technology is explained in detail in Delaware I. Delaware I, 234 F.3d at 1321-24, 58 USPQ2d at 1034-36.

The '365 patent deals with genetically altering plants to make them more resistant to insects. This is done by modifying the plants so that they express the Bacillus thuringiensis ("Bt") protein, which is toxic to various insects. Opinion, slip op. at 6. Bt is a naturally-occurring bacterium found in soil, and it produces the Bt protein. Prior to the invention claimed in the '365 patent, scientists had successfully introduced into plants the gene that codes for the Bt protein (the "Bt gene"). However the level of expression of the Bt protein by those plants was too low to be practicable. Id. at 7. The invention at the heart of the present suit solves that problem.

It was known in the art that, because of the degeneracy in the genetic code, more than one codon sequence would code for the Bt protein. The '365 patent uses this fact and alters the naturally occurring codon sequence of the Bt gene while still ensuring that the altered Bt gene codes for the Bt protein. The '365 patent explains that these alterations should be done so as to decrease the overall AT richness of the Bt gene. Decreasing the AT richness has the effect of removing sequences that the plant could read as regulatory sequences and which would interfere with the plant's ability to make the Bt protein. The end result of these alterations is an increase in the plant's expression of the Bt protein over that achieved by simply inserting the Bt gene as it is found in the Bt bacterium.

Claims 7-9 and 12 are at issue and are reproduced below.

7.A modified chimeric gene comprising a promoter which functions in plant cells operably linked to a structural coding sequence and a 3' non-translated region comprising a polyadenylation signal which functions in plants to cause the addition of polyadenylate nucleotides to the 3' end of the RNA, wherein said structural coding sequence encodes a toxin protein derived from a Bacillus thuringienis protein, wherein said structural coding sequence comprises a DNA sequence which differs from the naturally occurring DNA sequence encoding said Bacillus thuringiensis protein and comprises the following characteristics:

said naturally occurring DNA sequence comprises a region having the following sequence:

TTAATTAACCAAAGAATAGAAGAATTCGCTAGGAAC

1 51015 20 25 3035

and where said structural coding sequence comprises modifications so that at least said region contains at least one fewer sequence selected from the group consisting of an AACCAA and an AATTAA sequence.

8.The modified chimeric gene of claim 7 wherein said modifications increase the number of plant preferred codons in said structural coding sequence.

9.The modified chimeric gene of claim 7 wherein said Bacillus thuringiensis is Bacillus thuringiensis var. kurstaki.

. . . .

12.A transformed plant cell comprising a modified chimeric gene which comprises a promoter which functions in plant cells operably linked to a structural coding sequence and a 3' non-translated region comprising a polyadenylation signal which functions in plants to cause the addition of polyadenylate nucleotides to the 3' end of the RNA, wherein said structural coding sequence encodes a toxin protein derived from a Bacillus thuringiensis protein, wherein said structural coding sequence comprises a DNA sequence which differs from the naturally occurring DNA sequence encoding said Bacillus thuringiensis protein and has characteristics comprising the following:

said naturally occurring DNA sequence comprises a region having the following sequence:

TTAATTAACCAAAGAATAGAAGAATTCGCTAGGAAC

1 51015 20 25 3035

and where said structural coding sequence comprises modifications so that at least said region contains at least one fewer sequence selected from the group consisting of an AACCAA and an AATTAA sequence.

'365 patent, col. 46, l. 6 col. 48, l. 18.

At issue in the trial was whether the subject matter of the contested claims was invented by scientists at Agracetus, Inc. ("Agracetus") before it was invented by Monsanto. Agracetus is not related to the defendants and, at the time of the alleged invention by its scientists, was not related to Monsanto. However, Agracetus is now owned by Monsanto. There are three Agracetus scientists whose work, testimony, and lab notebooks are of interest in this appeal: Barton, Miller, and Cannon. Additionally, various discovery responses provide key information. The Agracetus inventions at issue are three modified Bt genes referred to as Bt2, Bt3, and Bt4. Agracetus made Bt2 by October 20, 1987, Bt3 by November 2, 1987, and Bt4 by January 15, 1988. Beginning on January 11, 1988, Agracetus began plant transformation experiments in which it inserted the modified Bt genes into plant cells. After these genetically altered plant cells had grown into plants, Agracetus tested the plants' toxicity beginning in May 1988. Toxicity was confirmed for the various Bt genes by performing hornworm bioassay tests on or about May 24-26, May 31 - June 2, July 6-8, and July 12-15, 1988. Western blot tests, confirming the genes' actual level of toxicity, were performed at least by August 11, 1988. These activities are relevant to Agracetus' conception, diligence, and reduction to practice, and are discussed in more detail in the analysis section, as are the dates of conception and reduction to practice for Monsanto.

B. Procedural History

The jury ruled in favor of Mycogen Plant Sciences, Inc. ("Mycogen") and the other defendants by determining that the scientists at Agracetus were prior inventors. Prior invention is governed by 35 U.S.C. § 102(g), which provides that:

A person shall be entitled to a patent unless

. . . .

(g) . . . (2) before such person's invention thereof, the invention was made in this country by another inventor who had not abandoned, suppressed, or concealed it. In determining priority of invention under this subsection, there shall be considered not only the respective dates of conception and reduction to practice of the invention, but also the reasonable diligence of one who was first to conceive and last to reduce to practice, from a time prior to conception by the other.

35 U.S.C. § 102 (Supp. V 1999). Section 102(g) provides multiple scenarios that can result in a finding of priority depending on the relative dates of conception and reduction to practice, as well as diligence. Although finding for the defendants, the jury verdict did not stipulate the grounds on which it found prior invention. That is, the jury did not make any specific findings regarding conception, diligence, or reduction to practice.

However, in response to the JMOL motions of the parties, the district court worked through the possible scenarios that could justify the jury's verdict. The district court first determined that no reasonable jury could have found that Agracetus had the earlier reduction to practice. Opinion, slip op. at 111. The district court then found, however, that a reasonable jury could have found that Agracetus conceived the claimed invention before Monsanto and was diligent during the required time period up to reduction to practice. Id. at 115.

Accordingly, the district court entered a judgment of invalidity under § 102(g) based on Agracetus' earlier conception coupled with diligence. Id. at 115, 148. Monsanto appeals the judgment of invalidity. We have exclusive jurisdiction. 28 U.S.C. § 1295(a)(1) (1994).

DISCUSSION
A. Standard of Review

In reviewing the...

Get this document and AI-powered insights with a free trial of vLex and Vincent AI

Get Started for Free

Start Your Free Trial of vLex and Vincent AI, Your Precision-Engineered Legal Assistant

  • Access comprehensive legal content with no limitations across vLex's unparalleled global legal database

  • Build stronger arguments with verified citations and CERT citator that tracks case history and precedential strength

  • Transform your legal research from hours to minutes with Vincent AI's intelligent search and analysis capabilities

  • Elevate your practice by focusing your expertise where it matters most while Vincent handles the heavy lifting

vLex

Start Your Free Trial of vLex and Vincent AI, Your Precision-Engineered Legal Assistant

  • Access comprehensive legal content with no limitations across vLex's unparalleled global legal database

  • Build stronger arguments with verified citations and CERT citator that tracks case history and precedential strength

  • Transform your legal research from hours to minutes with Vincent AI's intelligent search and analysis capabilities

  • Elevate your practice by focusing your expertise where it matters most while Vincent handles the heavy lifting

vLex

Start Your Free Trial of vLex and Vincent AI, Your Precision-Engineered Legal Assistant

  • Access comprehensive legal content with no limitations across vLex's unparalleled global legal database

  • Build stronger arguments with verified citations and CERT citator that tracks case history and precedential strength

  • Transform your legal research from hours to minutes with Vincent AI's intelligent search and analysis capabilities

  • Elevate your practice by focusing your expertise where it matters most while Vincent handles the heavy lifting

vLex

Start Your Free Trial of vLex and Vincent AI, Your Precision-Engineered Legal Assistant

  • Access comprehensive legal content with no limitations across vLex's unparalleled global legal database

  • Build stronger arguments with verified citations and CERT citator that tracks case history and precedential strength

  • Transform your legal research from hours to minutes with Vincent AI's intelligent search and analysis capabilities

  • Elevate your practice by focusing your expertise where it matters most while Vincent handles the heavy lifting

vLex

Start Your Free Trial of vLex and Vincent AI, Your Precision-Engineered Legal Assistant

  • Access comprehensive legal content with no limitations across vLex's unparalleled global legal database

  • Build stronger arguments with verified citations and CERT citator that tracks case history and precedential strength

  • Transform your legal research from hours to minutes with Vincent AI's intelligent search and analysis capabilities

  • Elevate your practice by focusing your expertise where it matters most while Vincent handles the heavy lifting

vLex

Start Your Free Trial of vLex and Vincent AI, Your Precision-Engineered Legal Assistant

  • Access comprehensive legal content with no limitations across vLex's unparalleled global legal database

  • Build stronger arguments with verified citations and CERT citator that tracks case history and precedential strength

  • Transform your legal research from hours to minutes with Vincent AI's intelligent search and analysis capabilities

  • Elevate your practice by focusing your expertise where it matters most while Vincent handles the heavy lifting

vLex
45 cases
  • Izume Products v. Koninklijke Philips Electronics
    • United States
    • U.S. District Court — District of Delaware
    • April 27, 2004
    ...other party's conception to ... [the date of] reduction to practice [by the party first to conceive]." Monsanto Co. v. Mycogen Plant Science, Inc., 261 F.3d 1356, 1369 (Fed.Cir.2002); Mahurkar, 79 F.3d at 1577. However, it is not necessary for a party alleging prior invention to drop all ot......
  • Barton v. Adang
    • United States
    • Patent Trial and Appeal Board
    • January 29, 2004
    ...affirmed. Monsanto Co. v. Mycogen Plant Science, Inc., 261 F.3d 1356, 1359, 59 U.S.P.Q.2d 1930, 1931 (Fed. Cir. 2001). At 1360, 59 U.S.P.Q.2d at 1932, Federal Circuit said, "Claims 7-9 and 12 are at issue . . . ." Claims 7-9 and 12 are drawn to modified chimeric genes, and plants transforme......
  • Kenexa Brassring Inc. v. Taleo Corp..
    • United States
    • U.S. District Court — District of Delaware
    • November 18, 2010
    ...the other party's conception to ... [the date of] reduction to practice [by the party first to conceive].” Monsanto Co. v. Mycogen Plant Sci., Inc., 261 F.3d 1356, 1369 (Fed.Cir.2001); Mahurkar, 79 F.3d at 1577. However, it is not necessary for a party alleging prior invention to drop all o......
  • Abbott Biotechnology Ltd. v. Centocor Ortho Biotech, Inc.
    • United States
    • U.S. District Court — District of Massachusetts
    • April 16, 2014
    ...not necessarily be evidence of activity on every single day if a satisfactory explanation is evidenced.” Monsanto Co. v. Mycogen Plant Sci., Inc., 261 F.3d 1356, 1369 (Fed.Cir.2001) (upholding diligence finding where record showed “activity in every month during the critical period”). “The ......
  • Get Started for Free
2 firm's commentaries
  • Antedating References at PTAB: Trends and Pitfalls
    • United States
    • JD Supra United States
    • April 18, 2017
    ...Group, Inc. v. Cree, Inc., 700 F.3d 1300, 1304-05 (Fed. Cir. 2012). [5] Purdue Pharma, 237 F.3d at 1365; Monsanto Co. v. Mycogen Plant Sci., 261 F.3d 1356, 1362-63 (Fed. Cir. 2001). [6] Medichem, S.A. v. Rolabo, S.L., 437 F.3d 1157, 1169 (Fed. Cir. 2006) (citing Cooper v. Goldfarb, 154 F.3d......
  • Keys To Successful Swear-Behind Attempts Before PTAB
    • United States
    • JD Supra United States
    • June 13, 2017
    ...Group, Inc. v. Cree, Inc., 700 F.3d 1300, 1304-05 (Fed. Cir. 2012). [3] Purdue Pharma, 237 F.3d at 1365; Monsanto Co. v. Mycogen Plant Sci., 261 F.3d 1356, 1362-63 (Fed. Cir. 2011). [4] 35 U.S.C. § 316(e); see Mahurkar v. C.R. Bard, Inc., 79 F.3d 1572, 1576 (Fed. Circ. 1996) (holding that t......
1 books & journal articles
  • Chapter §7.11 Prior Invention Under §102(g)
    • United States
    • Full Court Press Mueller on Patent Law Volume I: Patentability and Validity Title CHAPTER 7 Novelty, No Loss of Right, and Priority [Pre-America Invents Act of 2011]
    • Invalid date
    ...an actual reduction to practice so as to avoid holding of suppression or concealment).[889] See Monsanto Co. v. Mycogen Plant Sci., Inc., 261 F.3d 1356, 1369 (Fed. Cir. 2001).[890] 920 F.3d 1362 (Fed. Cir. Apr. 11, 2019) (Newman, J.).[891] ATI Techs., 920 F.3d at 1370.[892] ATI Techs., 920 ......